Stem-loop sequence dya-mir-33

AccessionMI0009636 (change log)
DescriptionDrosophila yakuba miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   ca      u    a  -g       u   c c        ucc a 
5'   gagaug cacg ag  ugcauug agu g auugucug   c a
     |||||| |||| ||  ||||||| ||| | ||||||||   |  
3'   cuuuac gugu uc  acgugac uca c uaacggac   g u
   ca      -    c  ga       u   a a        uuc u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3L: 20771330-20771419 [-]
intergenic
Database links

Mature sequence dya-miR-33

Accession MIMAT0009063
Sequence

15 - 

aggugcauuguagucgcauug

 - 35

Get sequence
Evidence by similarity; MI0000364

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).