Stem-loop sequence dya-mir-279

AccessionMI0009635 (change log)
DescriptionDrosophila yakuba miR-279 stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   au         u          a     c  ugcu     uug   u 
5'   acuacuguu uuagugggug ggguc ag    ucaca   auu u
     ||||||||| |||||||||| ||||| ||    |||||   ||| c
3'   ugauggcaa aauuacucac ccuag uc    agugu   uga u
   cu         u          a     a  ----     uua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3R: 21456052-21456144 [-]
intergenic
Database links

Mature sequence dya-miR-279

Accession MIMAT0009062
Sequence

60 - 

ugacuagauccacacucauuaa

 - 81

Get sequence
Evidence by similarity; MI0000363

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).