![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dya-mir-100 |
||||||||
Accession | MI0009633 (change log) | |||||||
Description | Drosophila yakuba miR-100 stem-loop | |||||||
Gene family | MIPF0000033; mir-10 | |||||||
Stem-loop |
-c a aa au aa - u uuu 5' cauu acaga cccguaa ccg cuugug c g u |||| ||||| ||||||| ||| |||||| | | 3' guaa ugucu ggguauu ggc gaacau g c a ac c ga ac ca u u uau |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence dya-miR-100 |
|
Accession | MIMAT0009059 |
Sequence |
12 - aacccguaaauccgaacuugug - 33 |
Evidence | by similarity; MI0000378 |
References |
|
1 |
PMID:17994087
"Evolution of genes and genomes on the Drosophila phylogeny"
Nature. 450:203-218(2007).
|