|
miRBase |
|
Stem-loop sequence dya-mir-100 |
||||||||
| Accession | MI0009633 | |||||||
| Description | Drosophila yakuba miR-100 stem-loop | |||||||
| Gene family | MIPF0000025; mir-99 | |||||||
| Stem-loop |
-c a aa au aa - u uuu cauu acaga cccguaa ccg cuugug c g u |||| ||||| ||||||| ||| |||||| | | guaa ugucu ggguauu ggc gaacau g c a ac c ga ac ca u u uau |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
Mature sequence dya-miR-100 |
|
| Accession | MIMAT0009059 |
| Sequence |
12 - aacccguaaauccgaacuugug - 33 |
| Evidence | by similarity; MI0000378 |
References |
|
| 1 |
PMID:17994087
"Evolution of genes and genomes on the Drosophila phylogeny"
Nature. 450:203-218(2007).
|