Stem-loop sequence dwi-mir-133

AccessionMI0009625 (change log)
DescriptionDrosophila willistoni miR-133 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   ua    -    aaug           cauc  gu     -  auuu 
5'   caac acug    uagcugguuga    gg  cagau cu    a
     |||| ||||    |||||||||||    ||  ||||| ||     
3'   guug ugac    gucgaccaacu    cc  guuua ga    u
   ua    g    -gau           -ucc  ug     c  aguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004521: 2027542-2027631 [+]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-133
dwi-mir-133scf2_1100000004521: 2027542-2027631 [+]
dwi-mir-288scf2_1100000004521: 2031457-2031550 [-]
Database links

Mature sequence dwi-miR-133

Accession MIMAT0009051
Sequence

56 - 

uugguccccuucaaccagcugu

 - 77

Get sequence
Evidence by similarity; MI0000362

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).