Stem-loop sequence dwi-mir-275

AccessionMI0009617 (change log)
DescriptionDrosophila willistoni miR-275 stem-loop
Gene family MIPF0000187; mir-275
Stem-loop
   --    cuu   u         -a    ug   ag     a  aauu 
5'   gucu   acc ugcgcgcua  ucag  acc  ggcug gu    u
     ||||   ||| |||||||||  ||||  |||  ||||| ||    u
3'   caga   ugg gcgcgcgau  aguc  ugg  cugac ua    a
   ac    uuu   u         ga    ca   -a     a  acuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004585: 5257600-5257692 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-275
dwi-mir-275scf2_1100000004585: 5257600-5257692 [-]
dwi-mir-305scf2_1100000004585: 5257391-5257464 [-]
Database links

Mature sequence dwi-miR-275

Accession MIMAT0009045
Sequence

58 - 

ucagguaccugaaguagcgcgcg

 - 80

Get sequence
Evidence by similarity; MI0000356

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).