Stem-loop sequence dwi-mir-31a

AccessionMI0009616 (change log)
DescriptionDrosophila willistoni miR-31a stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
         uuuc        a     u         ugauaauau 
5' ucuguu    gaauuggc agaug cggcauagc         u
   ||||||    |||||||| ||||| |||||||||         u
3' agauaa    uuugacug ucuac gucguaucg         u
         cuua        a     -         cgaaaagau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004513: 4557880-4557967 [-]
intergenic
Database links

Mature sequence dwi-miR-31a

Accession MIMAT0009044
Sequence

15 - 

uggcaagaugucggcauagcuga

 - 37

Get sequence
Evidence by similarity; MI0000420

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).