Stem-loop sequence dwi-mir-5

AccessionMI0009613 (change log)
DescriptionDrosophila willistoni miR-5 stem-loop
Gene family MIPF0000309; mir-5
Stem-loop
   --    -       c              ---   uuag 
5'   gcua aaaggaa gaucguugugauau   gcg    a
     |||| ||||||| ||||||||||||||   |||     
3'   cgau uuuccuu uuagugacacuaua   ugc    u
   cg    a       -              uau   cacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004514: 1651468-1651540 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-5
dwi-mir-309scf2_1100000004514: 1652078-1652161 [+]
dwi-mir-3scf2_1100000004514: 1651934-1652011 [-]
dwi-mir-286scf2_1100000004514: 1651753-1651860 [-]
dwi-mir-4scf2_1100000004514: 1651610-1651690 [-]
dwi-mir-5scf2_1100000004514: 1651468-1651540 [-]
dwi-mir-6-1scf2_1100000004514: 1651330-1651398 [-]
dwi-mir-6-2scf2_1100000004514: 1651147-1651240 [-]
dwi-mir-6-3scf2_1100000004514: 1651001-1651076 [-]
Database links

Mature sequence dwi-miR-5

Accession MIMAT0009041
Sequence

5 - 

aaaggaacgaucguugugauaug

 - 27

Get sequence
Evidence by similarity; MI0000123

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).