Stem-loop sequence dwi-mir-31b

AccessionMI0009605 (change log)
DescriptionDrosophila willistoni miR-31b stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   ---       g u     a     uc  a       aaagucacacaaaaucauaaaauguuugccguuu 
5'    acuagug a uuggc agaug  gg auagcug                                  u
      ||||||| | ||||| |||||  || |||||||                                   
3'    ugauuac u aacug ucuac  cc uaucggc                                  g
   guu       g u     a     -u  g       auuaaaaacuuuaguuauuuuaaguguuguuauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004963: 794488-794625 [+]
intergenic
Database links

Mature sequence dwi-miR-31b

Accession MIMAT0009037
Sequence

12 - 

uggcaagaugucggaauagcug

 - 33

Get sequence
Evidence by similarity; MI0000410

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).