Stem-loop sequence dwi-mir-6-3

AccessionMI0009588 (change log)
DescriptionDrosophila willistoni miR-6-3 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
   aa             ug    u      ---g  u  ca 
5'   agaagggaacggu  cugu gaugua    ua ac  u
     |||||||||||||  |||| ||||||    || ||   
3'   uuuuuucuugucg  gaca cuauau    au ug  u
   ug             gu    -      aaca  u  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004514: 1651001-1651076 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-6-3
dwi-mir-309scf2_1100000004514: 1652078-1652161 [+]
dwi-mir-3scf2_1100000004514: 1651934-1652011 [-]
dwi-mir-286scf2_1100000004514: 1651753-1651860 [-]
dwi-mir-4scf2_1100000004514: 1651610-1651690 [-]
dwi-mir-5scf2_1100000004514: 1651468-1651540 [-]
dwi-mir-6-1scf2_1100000004514: 1651330-1651398 [-]
dwi-mir-6-2scf2_1100000004514: 1651147-1651240 [-]
dwi-mir-6-3scf2_1100000004514: 1651001-1651076 [-]
Database links

Mature sequence dwi-miR-6

Accession MIMAT0009022
Sequence

52 - 

uaucacaguggcuguucuuuuu

 - 73

Get sequence
Evidence by similarity; MI0000124

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).