Stem-loop sequence dwi-mir-309

AccessionMI0009587 (change log)
DescriptionDrosophila willistoni miR-309 stem-loop
Stem-loop
         a  c      cacc    ga   ---         u 
5' auuaua ga aaacuu    cagu  ugc   uaaggaauu u
   |||||| || ||||||    ||||  |||   ||||||||| c
3' uaauau cu uuugaa    guca  acg   guuuuuuag u
         a  a      acaa    aa   uua         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004514: 1652078-1652161 [+]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-309
dwi-mir-6-3scf2_1100000004514: 1651001-1651076 [-]
dwi-mir-6-2scf2_1100000004514: 1651147-1651240 [-]
dwi-mir-6-1scf2_1100000004514: 1651330-1651398 [-]
dwi-mir-5scf2_1100000004514: 1651468-1651540 [-]
dwi-mir-4scf2_1100000004514: 1651610-1651690 [-]
dwi-mir-286scf2_1100000004514: 1651753-1651860 [-]
dwi-mir-3scf2_1100000004514: 1651934-1652011 [-]
dwi-mir-309scf2_1100000004514: 1652078-1652161 [+]
Database links

Mature sequence dwi-miR-309

Accession MIMAT0009021
Sequence

5 - 

uaagacaaacuucacccaguga

 - 26

Get sequence
Evidence by similarity; MI0000421

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).