Stem-loop sequence dwi-mir-8

AccessionMI0009580 (change log)
DescriptionDrosophila willistoni miR-8 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
           cu uu -       -   g     c      ---u       
5' aaggacau  g  c acaucuu acc ggcag auuaga    uuugua 
   ||||||||  |  | ||||||| ||| ||||| ||||||    ||||| c
3' uuccugug  c  g uguagaa ugg cuguc uaaucu    agauau 
           -- cu c       a   a     a      cuau       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004513: 6381486-6381577 [+]
intergenic
Database links

Mature sequence dwi-miR-8

Accession MIMAT0009013
Sequence

58 - 

uaauacugucagguaaagauguc

 - 80

Get sequence
Evidence by similarity; MI0000128

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).