Stem-loop sequence dwi-mir-79-1

AccessionMI0009579 (change log)
DescriptionDrosophila willistoni miR-79-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   uu             cgc       g     --   au 
5'   gccuaugcuuugg   uuuagcu uauga  uag  u
     |||||||||||||   ||||||| |||||  |||   
3'   cggguacgaaacc   agaucga auacu  auc  u
   cu             auu       a     uc   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004874: 28872-28947 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-79-1
dwi-mir-9c-1scf2_1100000004874: 30527-30617 [-]
dwi-mir-306-1scf2_1100000004874: 29027-29090 [-]
dwi-mir-79-1scf2_1100000004874: 28872-28947 [-]
dwi-mir-9b-1scf2_1100000004874: 28642-28731 [-]
Database links

Mature sequence dwi-miR-79

Accession MIMAT0008981
Sequence

49 - 

uaaagcuagauuaccaaagcau

 - 70

Get sequence
Evidence by similarity; MI0000374

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).