Stem-loop sequence dwi-mir-2a-1

AccessionMI0009575 (change log)
DescriptionDrosophila willistoni miR-2a-1 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
     u       -     -         a    auuauuu 
5' gc gagcuca caaag ugguuguga augc       g
   || ||||||| ||||| ||||||||| ||||       c
3' cg cucgagu guuuc accgacacu uacg       u
     u       a     g         a    accuauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004521: 4284690-4284766 [+]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-2a-1
dwi-mir-2bscf2_1100000004521: 4283218-4283300 [+]
dwi-mir-2a-1scf2_1100000004521: 4284690-4284766 [+]
dwi-mir-2a-2scf2_1100000004521: 4285060-4285131 [+]
Database links

Mature sequence dwi-miR-2a

Accession MIMAT0009006
Sequence

50 - 

uaucacagccagcuuugaugagc

 - 72

Get sequence
Evidence by similarity; MI0000117

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).