Stem-loop sequence dwi-mir-306-2

AccessionMI0009574 (change log)
DescriptionDrosophila willistoni miR-306-2 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
   --g  c      uu    a       agaaua 
5'    cu agguac  agug cucucaa      u
      || ||||||  |||| |||||||      a
3'    ga uccaug  ucgc gagaguu      u
   uca  -      uc    a       cagaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004945: 873736-873799 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-306-2
dwi-mir-9c-2scf2_1100000004945: 875221-875311 [-]
dwi-mir-306-2scf2_1100000004945: 873736-873799 [-]
dwi-mir-79-2scf2_1100000004945: 873577-873652 [-]
dwi-mir-9b-2scf2_1100000004945: 873347-873436 [-]
Database links

Mature sequence dwi-miR-306

Accession MIMAT0008986
Sequence

3 - 

ucagguacuuagugacucucaa

 - 24

Get sequence
Evidence by similarity; MI0000414

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).