Stem-loop sequence dwi-mir-286

AccessionMI0009565 (change log)
DescriptionDrosophila willistoni miR-286 stem-loop
Gene family MIPF0000225; mir-286
Stem-loop
   --       aaug    u   -    a     u      ----------c       cu 
5'   aaaauug    gcga ugu cggu uaguc cuuuuu           caaaaau  u
     |||||||    |||| ||| |||| ||||| ||||||           |||||||  g
3'   uuuuaau    ugcu aca gcca aucag gaaaga           guuuuug  u
   aa       aucg    c   a    g     u      auaaucuaacc       uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004514: 1651753-1651860 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-286
dwi-mir-309scf2_1100000004514: 1652078-1652161 [+]
dwi-mir-3scf2_1100000004514: 1651934-1652011 [-]
dwi-mir-286scf2_1100000004514: 1651753-1651860 [-]
dwi-mir-4scf2_1100000004514: 1651610-1651690 [-]
dwi-mir-5scf2_1100000004514: 1651468-1651540 [-]
dwi-mir-6-1scf2_1100000004514: 1651330-1651398 [-]
dwi-mir-6-2scf2_1100000004514: 1651147-1651240 [-]
dwi-mir-6-3scf2_1100000004514: 1651001-1651076 [-]
Database links

Mature sequence dwi-miR-286

Accession MIMAT0008999
Sequence

76 - 

ugacuagaccgaacacucgugcu

 - 98

Get sequence
Evidence by similarity; MI0000380

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).