Stem-loop sequence dwi-mir-9c-1

AccessionMI0009559 (change log)
DescriptionDrosophila willistoni miR-9c-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   -   uu    uuu         ucu    g     u  uuuu   a 
5'  uuu  gcug   cuuugguau   agcu uagau gu    ugc c
    |||  ||||   |||||||||   |||| ||||| ||    ||| a
3'  aaa  cgac   gaaaccaua   ucga aucua ua    aug u
   u   uu    cuc         uuu    a     c  ---u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004874: 30527-30617 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-9c-1
dwi-mir-9c-1scf2_1100000004874: 30527-30617 [-]
dwi-mir-306-1scf2_1100000004874: 29027-29090 [-]
dwi-mir-79-1scf2_1100000004874: 28872-28947 [-]
dwi-mir-9b-1scf2_1100000004874: 28642-28731 [-]
Database links

Mature sequence dwi-miR-9c

Accession MIMAT0008992
Sequence

12 - 

ucuuugguauucuagcuguaga

 - 33

Get sequence
Evidence by similarity; MI0000413

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).