Stem-loop sequence dwi-mir-285

AccessionMI0009552 (change log)
DescriptionDrosophila willistoni miR-285 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   ----     ga    u      a    uaauaugc   u  uau 
5'     acuga  ucga uggugc uaga        gaa uc   c
       |||||  |||| |||||| ||||        ||| ||    
3'     ugacu  agcu accacg aucu        cuu ag   a
   uucg     aa    u      -    -uaacuua   u  uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004762: 5768901-5768984 [+]
intergenic
Database links

Mature sequence dwi-miR-285

Accession MIMAT0008984
Sequence

61 - 

uagcaccauucgaaaucagugc

 - 82

Get sequence
Evidence by similarity; MI0000377

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).