Stem-loop sequence dvi-let-7

AccessionMI0009548 (change log)
DescriptionDrosophila virilis let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention dvi-let-7
(5 sentences)

Stem-loop
     u      uu   g     g           gua  u 
5' uc ggcaaa  gag uagua guuguauagua   uu a
   || ||||||  ||| ||||| |||||||||||   ||  
3' ag ucguuu  uuc aucgu cgacauaucau   ag u
     u      cu   g     g           acg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12963: 18451352-18451429 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-let-7
dvi-mir-100scaffold_12963: 18449845-18449926 [+]
dvi-let-7scaffold_12963: 18451352-18451429 [+]
dvi-mir-125scaffold_12963: 18451658-18451767 [+]
Database links

Mature sequence dvi-let-7

Accession MIMAT0008980
Sequence

11 - 

ugagguaguagguuguauagu

 - 31

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).