Stem-loop sequence dvi-mir-92a

AccessionMI0009547 (change log)
DescriptionDrosophila virilis miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention dvi-mir-92a
(7 sentences)

Stem-loop
   --        gc   a     -     u   c    --ug u 
5'   aacugcuu  agg cggga aggug caa guuu    c u
     ||||||||  ||| ||||| ||||| ||| ||||    | u
3'   uuggcgag  ucc gcccu uucac guu caaa    g a
   gu        ua   g     g     -   a    cuaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 6880792-6880872 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-92a
dvi-mir-92ascaffold_12855: 6880792-6880872 [+]
dvi-mir-92bscaffold_12855: 6883810-6883900 [+]
Database links

Mature sequence dvi-miR-92a-5p

Accession MIMAT0032099
Sequence

11 - 

aggacgggaaggugucaacguu

 - 32

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-92a-3p

Accession MIMAT0008979
Previous IDsdvi-miR-92a
Sequence

50 - 

cauugcacuugucccggccuau

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).