Stem-loop sequence dvi-mir-284

AccessionMI0009545 (change log)
DescriptionDrosophila virilis miR-284 stem-loop
Gene family MIPF0000228; mir-284
Stem-loop
   --         c            ---     g    -  -c    a   g 
5'   guugcaguu cuggaauuaagu   ugacu ugua gc  ugua agg a
     ||||||||| ||||||||||||   ||||| |||| ||  |||| ||| a
3'   cggcguuaa gaccuuaguuca   acuga acau cg  acgu uuc g
   cc         c            acg     a    u  uc    g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 584480-584577 [+]
intergenic
Database links

Mature sequence dvi-miR-284-5p

Accession MIMAT0032097
Sequence

10 - 

ccuggaauuaaguugacuguguagc

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-284-3p

Accession MIMAT0008977
Previous IDsdvi-miR-284
Sequence

64 - 

caaagucagcaacuugauuccagcaauug

 - 92

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).