Stem-loop sequence dvi-mir-304

AccessionMI0009544 (change log)
DescriptionDrosophila virilis miR-304 stem-loop
Gene family MIPF0000308; mir-304
Stem-loop
       ca    u       aau       u     c auu    a 
5' gcag  uuga uaaucuc   uuguaaa gugag g   uuaa g
   ||||  |||| |||||||   ||||||| ||||| |   |||| u
3' cguu  agcu guuagag   aacguuu cacuc c   aguu a
       ag    c       guu       -     a -gc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 2048753-2048841 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-304
dvi-mir-283scaffold_12970: 2047663-2047757 [+]
dvi-mir-304scaffold_12970: 2048753-2048841 [+]
dvi-mir-12scaffold_12970: 2049328-2049401 [+]
Database links

Mature sequence dvi-miR-304-5p

Accession MIMAT0008976
Previous IDsdvi-miR-304
Sequence

12 - 

uaaucucaauuuguaaauguga

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-304-3p

Accession MIMAT0032096
Sequence

59 - 

cacuuugcaauuggagauugcu

 - 80

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).