Stem-loop sequence dvi-mir-275

AccessionMI0009538 (change log)
DescriptionDrosophila virilis miR-275 stem-loop
Gene family MIPF0000187; mir-275
Stem-loop
   --    -u               -a    ug   gg     guuu   u 
5'   gucu  uuaccgugcgcgcua  ucag  acc  ggcug    ugg u
     ||||  |||||||||||||||  ||||  |||  |||||    ||| a
3'   caga  gguggugcgcgcgau  aguc  ugg  cugac    acc u
   ug    cc               ga    ca   -a     ----   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12963: 15419968-15420059 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-275
dvi-mir-275scaffold_12963: 15419968-15420059 [-]
dvi-mir-305scaffold_12963: 15419842-15419914 [-]
Database links

Mature sequence dvi-miR-275-5p

Accession MIMAT0032091
Sequence

14 - 

cgcgcuaaucagugaccggggcu

 - 36

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-275-3p

Accession MIMAT0008970
Previous IDsdvi-miR-275
Sequence

56 - 

ucagguaccugaaguagcgcgcg

 - 78

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).