Stem-loop sequence dvi-mir-285

AccessionMI0009536 (change log)
DescriptionDrosophila virilis miR-285 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --  a   -u    a     ga    u      a    uaucgcccaaaaa 
5'   uc aau  gaag acuga  ucga uggugc uaga             g
     || |||  |||| |||||  |||| |||||| ||||              
3'   ag uua  uuuc ugacu  agcu accacg aucu             u
   ca  c   uu    g     aa    u      -    uaacuuuacuuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 21101441-21101540 [+]
intergenic
Database links

Mature sequence dvi-miR-285-5p

Accession MIMAT0032089
Sequence

13 - 

acugagaucgauuggugcauaga

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-285-3p

Accession MIMAT0008969
Previous IDsdvi-miR-285
Sequence

66 - 

uagcaccauucgaaaucagugc

 - 87

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).