Stem-loop sequence dvi-mir-308

AccessionMI0009535 (change log)
DescriptionDrosophila virilis miR-308 stem-loop
Gene family MIPF0000171; mir-308
Stem-loop
              c       u    -   au 
5' cucgcaguaua uuuugug uuug uuu  u
   ||||||||||| ||||||| |||| |||  u
3' gagugucauau aggacac aaac aaa  u
              u       u    u   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 17605307-17605368 [+]
intergenic
Database links

Mature sequence dvi-miR-308-5p

Accession MIMAT0032088
Sequence

3 - 

cgcaguauacuuuuguguuuug

 - 24

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-308-3p

Accession MIMAT0008968
Previous IDsdvi-miR-308
Sequence

41 - 

aaucacaggauuauacugugag

 - 62

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).