Stem-loop sequence dvi-mir-92b

AccessionMI0009530 (change log)
DescriptionDrosophila virilis miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention dvi-mir-92b
(7 sentences)

Stem-loop
   aa  u   - uga         u c       uu     -----   u 
5'   cg cac c   uguaggucg g cuggugc  auuug     uug u
     || ||| |   ||||||||| | |||||||  |||||     ||| a
3'   gc gug g   acguccggc c gaucacg  uaaac     agc u
   ac  u   a -ug         c u       -u     cuaaa   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 6883810-6883900 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-92b
dvi-mir-92ascaffold_12855: 6880792-6880872 [+]
dvi-mir-92bscaffold_12855: 6883810-6883900 [+]
Database links

Mature sequence dvi-miR-92b-5p

Accession MIMAT0032085
Sequence

16 - 

aggucgugccuggugcuuauuug

 - 38

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-92b-3p

Accession MIMAT0008962
Previous IDsdvi-miR-92b
Sequence

57 - 

aauugcacuagucccggccugc

 - 78

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).