Stem-loop sequence dvi-mir-1

Accession MI0009527
Description Drosophila virilis miR-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--   uuu  --ga            c        aaua    u aa 
  gcc   ga    guuccaugcuuc uuacauuc    guau c  a
  |||   ||    |||||||||||| ||||||||    |||| |   
  cgg   cu    cgagguaugaag aauguaag    uaua g  u
ag   --u  aaag            a        ---g    c aa 
Get sequence
Genome context
Coordinates (FB2011_07) Overlapping transcripts
scaffold_12963: 13613429-13613515 [-]
intergenic

Mature sequence dvi-miR-1

Accession MIMAT0008959
Sequence

53 - 

uggaauguaaagaaguauggag

 - 74

Get sequence
Evidence by similarity; MI0000116

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).