Stem-loop sequence dvi-mir-307

AccessionMI0009520 (change log)
DescriptionDrosophila virilis miR-307 stem-loop
Gene family MIPF0000293; mir-67
Stem-loop
            -   a         ccu  g       uuaguuc   u 
5' ugucuugcu uug cucacucaa   gg ugugaug       gau u
   ||||||||| ||| |||||||||   || |||||||       ||| g
3' auaggacga agc gagugaguu   cc acacuac       cua g
            u   -         ccu  a       -------   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 5789456-5789543 [-]
intergenic
Database links

Mature sequence dvi-miR-307

Accession MIMAT0008953
Sequence

56 - 

ucacaaccuccuugagugagc

 - 76

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).