Stem-loop sequence dvi-mir-305

AccessionMI0009506 (change log)
DescriptionDrosophila virilis miR-305 stem-loop
Gene family MIPF0000158; mir-305
Literature search

1 open access papers mention dvi-mir-305
(1 sentences)

Stem-loop
        cu u         u  g     cu  u  gac 
5' caugu  a uguacuuca ca gugcu  gg gu   u
   |||||  | ||||||||| || |||||  || ||    
3' guaua  u acaugaagu gu cacgg  cc ca   u
        ac c         u  a     --  -  aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12963: 15419842-15419914 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-305
dvi-mir-275scaffold_12963: 15419968-15420059 [-]
dvi-mir-305scaffold_12963: 15419842-15419914 [-]
Database links

Mature sequence dvi-miR-305-5p

Accession MIMAT0008940
Previous IDsdvi-miR-305
Sequence

8 - 

auuguacuucaucaggugcuc

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-305-3p

Accession MIMAT0032066
Sequence

46 - 

cggcacauguugaaguacacuca

 - 68

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).