Stem-loop sequence dvi-mir-283

AccessionMI0009501 (change log)
DescriptionDrosophila virilis miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   cc     uc      aa           u         a --ca   cc 
5'   gauuc  aaaggu  auaucagcugg aauucuggg g    aug  u
     |||||  ||||||  ||||||||||| ||||||||| |    |||   
3'   uuaag  uuuuca  uaugguugacu uuaaggcuc c    uau  a
   --     uu      gc           -         a aaag   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 2047663-2047757 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-283
dvi-mir-283scaffold_12970: 2047663-2047757 [+]
dvi-mir-304scaffold_12970: 2048753-2048841 [+]
dvi-mir-12scaffold_12970: 2049328-2049401 [+]
Database links

Mature sequence dvi-miR-283-5p

Accession MIMAT0008935
Previous IDsdvi-miR-283
Sequence

16 - 

aaauaucagcugguaauucuggg

 - 38

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-283-3p

Accession MIMAT0032061
Sequence

63 - 

cggaauuucaguugguaucgac

 - 84

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).