Stem-loop sequence dvi-mir-310

AccessionMI0009500 (change log)
DescriptionDrosophila virilis miR-310 stem-loop
Gene family MIPF0000566; mir-310
Literature search

1 open access papers mention dvi-mir-310
(1 sentences)

Stem-loop
   au     u       u cuc     g      u  uua 
5'   cauuu uaggccg g   ugugu aauaug uu   a
     ||||| ||||||| |   ||||| |||||| ||    
3'   gugaa auccggc c   acacg uuauac aa   c
   -u     u       c ucu     -      u  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 13668747-13668822 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-310
dvi-mir-313scaffold_12875: 13669117-13669187 [-]
dvi-mir-311scaffold_12875: 13668884-13668990 [-]
dvi-mir-310scaffold_12875: 13668747-13668822 [-]
Database links

Mature sequence dvi-miR-310-5p

Accession MIMAT0032060
Sequence

10 - 

aggccgugcucugugugaauaug

 - 32

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-310-3p

Accession MIMAT0008934
Previous IDsdvi-miR-310
Sequence

49 - 

uauugcacaucucccggccuau

 - 70

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).