Stem-loop sequence dvi-mir-315b

AccessionMI0009499 (change log)
DescriptionDrosophila virilis miR-315b stem-loop
Stem-loop
   uu     uug   g   u     -----   c 
5'   caauu   auu uug acaga     aac u
     |||||   ||| ||| |||||     |||  
3'   guuaa   uaa agc uguuu     uug a
   au     ---   g   u     aauua   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13047: 2458056-2458113 [+]
intergenic
Database links

Mature sequence dvi-miR-315b

Accession MIMAT0008933
Sequence

6 - 

uuuugauuguuguacagaaacc

 - 27

Get sequence
Evidence by similarity; MI0000427

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).