Stem-loop sequence dvi-mir-282

AccessionMI0009498 (change log)
DescriptionDrosophila virilis miR-282 stem-loop
Gene family MIPF0000150; mir-282
Stem-loop
   aa uu    -auaa           ac      u      ugcau   a 
5'   u  ccuu     aucuagccucu  uaggcu ugucug     ucg u
     |  ||||     |||||||||||  |||||| ||||||     ||| a
3'   a  ggaa     uggauuggaga  auccga acagac     ggc u
   -- gg    ccaug           gu      u      ----u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12758: 910711-910804 [-]
intergenic
Database links

Mature sequence dvi-miR-282-5p

Accession MIMAT0008932
Previous IDsdvi-miR-282
Sequence

21 - 

cucuacuaggcuuugucu

 - 38

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-282-3p

Accession MIMAT0032059
Sequence

60 - 

acauagccuaugagagguuagg

 - 81

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).