Stem-loop sequence dvi-mir-9a

AccessionMI0009495 (change log)
DescriptionDrosophila virilis miR-9a stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention dvi-mir-9a
(4 sentences)

Stem-loop
   cu      u       uau      g     -  gau 
5'   auguug cuuuggu   cuagcu uauga gu   a
     |||||| |||||||   |||||| ||||| ||    
3'   uauaau gaagcca   gaucga auacu ca   a
   au      u       uuc      a     g  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 13137024-13137098 [+]
intergenic
Database links

Mature sequence dvi-miR-9a-5p

Accession MIMAT0008929
Previous IDsdvi-miR-9a
Sequence

9 - 

ucuuugguuaucuagcuguauga

 - 31

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-9a-3p

Accession MIMAT0032057
Sequence

48 - 

uaaagcuagcuuaccgaaguua

 - 69

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).