Stem-loop sequence dvi-mir-210

AccessionMI0009494 (change log)
DescriptionDrosophila virilis miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   --   -a     ugc        gc   -         uuaga 
5'   ggu  cuuau   agcugcug  cac ugcacaaga     c
     |||  |||||   ||||||||  ||| |||||||||     u
3'   cca  gaaug   ucggcgac  gug gcguguucu     c
   ga   ga     uua        -a   u         cagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12928: 1257219-1257302 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-210
dvi-mir-969scaffold_12928: 1264079-1264199 [-]
dvi-mir-210scaffold_12928: 1257219-1257302 [-]
Database links

Mature sequence dvi-miR-210-5p

Accession MIMAT0032056
Sequence

13 - 

agcugcuggccacugcacaaga

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-210-3p

Accession MIMAT0008928
Previous IDsdvi-miR-210
Sequence

50 - 

uugugcgugugacagcggcua

 - 70

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).