Stem-loop sequence dvi-mir-9c

AccessionMI0009491 (change log)
DescriptionDrosophila virilis miR-9c stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention dvi-mir-9c
(4 sentences)

Stem-loop
       uu    uuu         ucu    g     u uuuu   a 
5' auuu  gcug   cuuugguau   agcu uagau g    uac g
   ||||  ||||   |||||||||   |||| ||||| |    ||| u
3' uaaa  cgac   gaaaccaua   ucga aucua c    aug u
       uu    cuc         uuu    a     - ---u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12963: 12863849-12863937 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9c
dvi-mir-9cscaffold_12963: 12863849-12863937 [-]
dvi-mir-306scaffold_12963: 12863214-12863292 [-]
dvi-mir-79scaffold_12963: 12863042-12863133 [-]
dvi-mir-9bscaffold_12963: 12862861-12862949 [-]
Database links

Mature sequence dvi-miR-9c-5p

Accession MIMAT0008924
Previous IDsdvi-miR-9c
Sequence

13 - 

ucuuugguauucuagcuguaga

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-9c-3p

Accession MIMAT0032054
Sequence

58 - 

uaaagcuuuuauaccaaagcu

 - 78

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).