Stem-loop sequence dvi-mir-306

AccessionMI0009481 (change log)
DescriptionDrosophila virilis miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
   cc  u  u       uu            ucaucuau     
5'   gc gc cagguac  agugacucucaa        ugcu 
     || || |||||||  ||||||||||||        ||| u
3'   cg cg guccgug  ucgcugggaguu        acgu 
   uc  c  u       uc            ----ccau     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12963: 12863214-12863292 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-306
dvi-mir-9cscaffold_12963: 12863849-12863937 [-]
dvi-mir-306scaffold_12963: 12863214-12863292 [-]
dvi-mir-79scaffold_12963: 12863042-12863133 [-]
dvi-mir-9bscaffold_12963: 12862861-12862949 [-]
Database links

Mature sequence dvi-miR-306-5p

Accession MIMAT0008913
Previous IDsdvi-miR-306
Sequence

8 - 

ucagguacuuagugacucuca

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-306-3p

Accession MIMAT0008914
Previous IDsdvi-miR-306*
Sequence

53 - 

gagggucgcucugugccugugc

 - 74

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).