Stem-loop sequence dvi-mir-2c

AccessionMI0009478 (change log)
DescriptionDrosophila virilis miR-2c stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention dvi-mir-2c
(1 sentences)

Stem-loop
   ca    uua    -       -      aag     a  -     a  ucu 
5'   uguc   cuuu caauguc aucaaa   ggcug ga augau ua   g
     ||||   |||| ||||||| ||||||   ||||| || ||||| ||    
3'   acgg   gaaa guuacgg uaguuu   ccgac cu ugcua gu   c
   ca    ---    c       g      cga     a  a     a  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13047: 13335417-13335514 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-2c
dvi-mir-2cscaffold_13047: 13335417-13335514 [+]
dvi-mir-13ascaffold_13047: 13335637-13335710 [+]
dvi-mir-13b-1scaffold_13047: 13335793-13335860 [+]
Database links

Mature sequence dvi-miR-2c-5p

Accession MIMAT0032044
Sequence

19 - 

ucaucaaaaagggcugagaau

 - 39

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-2c-3p

Accession MIMAT0008910
Previous IDsdvi-miR-2c
Sequence

61 - 

uaucacagccagcuuugaugggc

 - 83

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).