Stem-loop sequence dvi-mir-314

AccessionMI0009475 (change log)
DescriptionDrosophila virilis miR-314 stem-loop
Gene family MIPF0000246; mir-314
Stem-loop
   u  u       g        au     ugguu    -      u  aac 
5'  cg aacuugu uggcuuga  guacc     gagg aacgaa uc   g
    || ||||||| ||||||||  |||||     |||| |||||| ||    
3'  gc uugaaua accgagcu  uaugg     uucc uuguuu ag   u
   g  -       -        --     ----u    g      u  guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 23988161-23988251 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-314
dvi-mir-314scaffold_13049: 23988161-23988251 [+]
dvi-mir-956scaffold_13049: 23989411-23989516 [-]
Database links

Mature sequence dvi-miR-314-5p

Accession MIMAT0032041
Sequence

3 - 

guaacuuguguggcuugaauguacc

 - 27

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-314-3p

Accession MIMAT0008908
Previous IDsdvi-miR-314
Sequence

71 - 

uauucgagccaauaaguucgg

 - 91

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).