Stem-loop sequence dsi-mir-6-2

AccessionMI0009473 (change log)
DescriptionDrosophila simulans miR-6-2 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
        cc       uu ug   c       -uua  g 
5' uaacc  agggaac  c  cug ugauaua    uu a
   |||||  |||||||  |  ||| |||||||    ||  
3' guugg  uuucuug  g  gac acuauau    aa a
        uu       uc gu   -       ccuc  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 14253809-14253882 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-6-2
dsi-mir-309chr2R: 14254644-14254712 [-]
dsi-mir-3chr2R: 14254533-14254601 [-]
dsi-mir-286chr2R: 14254362-14254461 [-]
dsi-mir-4chr2R: 14254228-14254308 [-]
dsi-mir-5chr2R: 14254101-14254163 [-]
dsi-mir-6-1chr2R: 14253951-14254021 [-]
dsi-mir-6-2chr2R: 14253809-14253882 [-]
dsi-mir-6-3chr2R: 14253656-14253735 [-]
Database links

Mature sequence dsi-miR-6-5p

Accession MIMAT0015283
Previous IDsdsi-miR-6*
Sequence

8 - 

agggaacuucugcugcugauaua

 - 30

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dsi-miR-6-3p

Accession MIMAT0008885
Previous IDsdsi-miR-6
Sequence

48 - 

uaucacaguggcuguucuuuuu

 - 69

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).