Stem-loop sequence dsi-mir-6-2

Accession MI0009473
Description Drosophila simulans miR-6-2 stem-loop
Gene family MIPF0000119; mir-6
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-6_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-6 microRNA precursor is a precursor microRNA specific to Drosophila species. In Drosophila melanogaster there are three mir-6 paralogs called dme-mir-6-1, dme-mir-6-2, dme-mir-6-3, which are clustered together in the genome. The extents of these hairpin precursors are estimated based on hairpin prediction. Each precursor is generated following the cleavage of a longer primary transcript in the nucleus, and is exported in the cytoplasm. In the cytoplasm, precursors are further processed by the enzyme Dicer, generating ~22 nucleotide products from each arm of the hairpin. The products generated from the 3' arm of each mir-6 precursor have identical sequences. Both 5' and 3' mature products are experimentally validated. Experimental data suggests that the mature products of mir-6 hairpins are expressed in the early embryo of Drosophila and target apoptotic genes such as hid, grim and rpr.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     cc       uu ug   c       -uua  g 
uaacc  agggaac  c  cug ugauaua    uu a
|||||  |||||||  |  ||| |||||||    ||  
guugg  uuucuug  g  gac acuauau    aa a
     uu       uc gu   -       ccuc  a 
Get sequence
Genome context
Coordinates (dsim_r1.3_FB2010_02) Overlapping transcripts
2R: 14253809-14253882 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-6-2
dsi-mir-309 2R: 14254644-14254712 [-]
dsi-mir-3 2R: 14254533-14254601 [-]
dsi-mir-286 2R: 14254362-14254461 [-]
dsi-mir-4 2R: 14254228-14254308 [-]
dsi-mir-5 2R: 14254101-14254163 [-]
dsi-mir-6-1 2R: 14253951-14254021 [-]
dsi-mir-6-2 2R: 14253809-14253882 [-]
dsi-mir-6-3 2R: 14253656-14253735 [-]

Mature sequence dsi-miR-6-5p

Accession MIMAT0015283
Previous IDs dsi-miR-6*
Sequence

8 - 

agggaacuucugcugcugauaua

 - 30

Get sequence
Evidence experimental; Solexa [2]

Mature sequence dsi-miR-6-3p

Accession MIMAT0008885
Previous IDs dsi-miR-6
Sequence

48 - 

uaucacaguggcuguucuuuuu

 - 69

Get sequence
Evidence experimental; Solexa [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).