Stem-loop sequence dsi-mir-184

AccessionMI0009471 (change log)
DescriptionDrosophila simulans miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   cc    c  u  ua         -     u  -  ccg   gcau 
5'   ggug au cg  cccuuauca uucuc cg cc   ugu    u
     |||| || ||  ||||||||| ||||| || ||   |||     
3'   ccac ua gc  gggaauagu aagag gc gg   aca    u
   aa    -  u  uc         c     -  a  uca   gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 7673847-7673934 [-]
intergenic
Database links

Mature sequence dsi-miR-184-5p

Accession MIMAT0008903
Previous IDsdsi-miR-184*
Sequence

16 - 

ccuuaucauucucucgccccg

 - 36

Get sequence
Evidence by similarity; MI0000354

Mature sequence dsi-miR-184-3p

Accession MIMAT0008904
Previous IDsdsi-miR-184
Sequence

55 - 

uggacggagaacugauaagggc

 - 76

Get sequence
Evidence by similarity; MI0000354

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).