Stem-loop sequence dsi-mir-133

AccessionMI0009468 (change log)
DescriptionDrosophila simulans miR-133 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   cu     -    ug             cauc  gu     -  guu 
5'   gcaac gcug  uguagcugguuga    gg  cagau cu   u
     ||||| ||||  |||||||||||||    ||  ||||| ||    
3'   cguug ugac  augucgaccaacu    cc  guuua ga   u
   gu     g    cg             -ucc  ug     c  auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2L: 20179937-20180027 [+]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-133
dsi-mir-133chr2L: 20179937-20180027 [+]
dsi-mir-288chr2L: 20181636-20181732 [-]
Database links

Mature sequence dsi-miR-133

Accession MIMAT0008900
Sequence

55 - 

uugguccccuucaaccagcugu

 - 76

Get sequence
Evidence by similarity; MI0000362

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).