Stem-loop sequence dsi-mir-6-3

AccessionMI0009467 (change log)
DescriptionDrosophila simulans miR-6-3 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
       a             ug   a        uucgaaa 
5' caaa agaagggaacggu  cug ugauguag       c
   |||| |||||||||||||  ||| ||||||||       u
3' guuu uuuuuucuugucg  gac acuauauu       c
       g             gu   -        uaacacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 14253656-14253735 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-6-3
dsi-mir-309chr2R: 14254644-14254712 [-]
dsi-mir-3chr2R: 14254533-14254601 [-]
dsi-mir-286chr2R: 14254362-14254461 [-]
dsi-mir-4chr2R: 14254228-14254308 [-]
dsi-mir-5chr2R: 14254101-14254163 [-]
dsi-mir-6-1chr2R: 14253951-14254021 [-]
dsi-mir-6-2chr2R: 14253809-14253882 [-]
dsi-mir-6-3chr2R: 14253656-14253735 [-]
Database links

Mature sequence dsi-miR-6-3p

Accession MIMAT0008885
Previous IDsdsi-miR-6
Sequence

53 - 

uaucacaguggcuguucuuuuu

 - 74

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).