Stem-loop sequence dsi-mir-276b

AccessionMI0009462 (change log)
DescriptionDrosophila simulans miR-276b stem-loop
Gene family MIPF0000124; mir-276
Stem-loop
   ac   -      uuua   uc    a     a           uuccu 
5'   cga agucuu    cca  agcg gguau gaguuccuacg     a
     ||| ||||||    |||  |||| ||||| |||||||||||      
3'   gcu ucagga    ggu  ucgu ccaua uucaaggaugc     u
   ca   g      ----   uc    g     a           ugacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3L: 9702914-9703006 [+]
intergenic
Database links

Mature sequence dsi-miR-276b

Accession MIMAT0008895
Sequence

57 - 

uaggaacuuaauaccgugcucu

 - 78

Get sequence
Evidence by similarity; MI0000375

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).