Stem-loop sequence dsi-mir-283

AccessionMI0009460 (change log)
DescriptionDrosophila simulans miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   ac     uc      aa           u         agcuaagccu 
5'   gauuc  aaaggu  auaucagcugg aauucuggg          a
     |||||  ||||||  ||||||||||| |||||||||           
3'   uuaag  uuuuca  uaugguugacu uuaaggcuc          a
   --     uu      gc           -         acaaaguaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dsi-miR-283

Accession MIMAT0008893
Sequence

15 - 

uaaauaucagcugguaauucu

 - 35

Get sequence
Evidence by similarity; MI0000368

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).