Stem-loop sequence dsi-mir-285

AccessionMI0009455 (change log)
DescriptionDrosophila simulans miR-285 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --  ga       -a     ga    u      a    --uaucag  aaa 
5'   uc  aucgaag  acuga  ucga uggugc uaga        ga   c
     ||  |||||||  |||||  |||| |||||| ||||        ||    
3'   ag  uaguuuu  ugacu  agcu accacg aucu        cu   c
   aa  aa       cg     aa    u      -    caacuuaa  cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3L: 11307970-11308067 [-]
intergenic
Database links

Mature sequence dsi-miR-285

Accession MIMAT0008888
Sequence

64 - 

uagcaccauucgaaaucagugc

 - 85

Get sequence
Evidence by similarity; MI0000377

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).