Stem-loop sequence dsi-mir-282

AccessionMI0009449 (change log)
DescriptionDrosophila simulans miR-282 stem-loop
Gene family MIPF0000150; mir-282
Stem-loop
   a    -    -uuaa           ac      u      ugcau   a 
5'  guuu ccuu     aucuagccucu  uaggcu ugucug     ucg a
    |||| ||||     |||||||||||  |||||| ||||||     ||| a
3'  caag ggaa     uggauuggaga  auccga acagac     agc g
   a    c    ccaug           au      u      ----u   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr3L: 2784396-2784492 [+]
intergenic
Database links

Mature sequence dsi-miR-282

Accession MIMAT0008883
Sequence

13 - 

aaucuagccucuacuaggcuuugucugu

 - 40

Get sequence
Evidence by similarity; MI0000367

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).