Stem-loop sequence dsi-mir-308

AccessionMI0009442 (change log)
DescriptionDrosophila simulans miR-308 stem-loop
Gene family MIPF0000171; mir-308
Stem-loop
              u       u    uuuc   u 
5' cucgcaguaua uuuugug uuug    guu u
   ||||||||||| ||||||| ||||    |||  
3' gagugucauau aggacac aaac    caa g
              u       u    ---u   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 8866671-8866733 [-]
intergenic
Database links

Mature sequence dsi-miR-308

Accession MIMAT0008877
Sequence

42 - 

aaucacaggauuauacugugag

 - 63

Get sequence
Evidence by similarity; MI0000419

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).