Stem-loop sequence dsi-mir-2b-1

AccessionMI0009423 (change log)
DescriptionDrosophila simulans miR-2b-1 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
     u    ug         -    g    ----c      u 
5' cu caac  ucuucaaag uggc guga     auguug c
   || ||||  ||||||||| |||| ||||     ||||||  
3' gg guug  aggaguuuc accg cacu     uauaac a
     c    cg         g    a    auacu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2L: 8042715-8042791 [-]
intergenic
Database links

Mature sequence dsi-miR-2b

Accession MIMAT0008858
Sequence

48 - 

uaucacagccagcuuugaggagc

 - 70

Get sequence
Evidence by similarity; MI0000120

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).