Stem-loop sequence dsi-mir-12

AccessionMI0009417 (change log)
DescriptionDrosophila simulans miR-12 stem-loop
Gene family MIPF0000181; mir-12
Stem-loop
         ug     u   u           -  gccug 
5' uacggu  aguau aca cagguacuggu gu     a
   ||||||  ||||| ||| ||||||||||| ||      
3' gugccg  ucaua ugu guucaugacca ca     a
         ca     c   -           a  accua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dsi-miR-12

Accession MIMAT0008852
Sequence

7 - 

ugaguauuacaucagguacuggu

 - 29

Get sequence
Evidence by similarity; MI0000132

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).