Stem-loop sequence dsi-mir-13b-2

AccessionMI0009410 (change log)
DescriptionDrosophila simulans miR-13b-2 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   uc   g          a      gcua      uu 
5'   aac cgucaaaaug cuguga    ugugga  u
     ||| |||||||||| ||||||    ||||||   
3'   uug gcaguuuuac gacacu    auacuu  g
   gu   a          c      ----      ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dsi-miR-13b

Accession MIMAT0008845
Sequence

44 - 

uaucacagccauuuugacgagu

 - 65

Get sequence
Evidence by similarity; MI0000134

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).